Journal of Plant Pathology (2012) 94, p. S88 (Oenelge et al.)

N. Önelge and M. Yurtmen (2012)
First report of Citrus viroid V in Turkey
Journal of Plant Pathology 94 (4, Suppl.), S88-S88
Abstract: The recently described Citrus viroid V (CVd-V) (Serra et al., 2008) has the typical features of members of the genus Apscaviroid. Our viroid-infected citrus collection which had been analyzed by sPAGE and found to be infected with different viroid species was checked again to determine whether CVd-V was present in Turkey. Viroidal RNAs extracted from 20 sweet orange plants were used as templates for RT-PCR with primer pairs P3/P4 [CVV-P3(h) CTGTGGGTCACCCCGCCC and CVV- P4(c) GAACCACAAGGTTGTTCACC] according to Ito and Ohta (2010). After electrophoresis of RT-PCR products in 1% agarose gel followed by ethidium bromide staining, bands of ca. 300 bp in size were detected in amplifications from five sweet orange samples. Amplified PCR products were purified using a Qiagen gel extraction kit and custom sequenced by Iontec Sequencing Service (Turkey). Nucleotide sequence analysis showed that CVd-V was 294 bp in length. Positive detection of CVd-V was confirmed by sPAGE and SSCP analysis. Analysis of the sequence of the 294 bp amplicon revealed 96% and 98% identity with CVd-V GenBank reference sequences EU433392.1 and AB560862, respectively. Members of the genus Apscaviroid infecting citrus are not associated with diseases but they cause mild stunting and synergistic effects in Etrog citron co-infected with CVd-V (Serra et al., 2008). Since all CVd-V-infected sweet orange trees analyzed contained also more than three viroid species, the effect of CVd-V was not clear. To the best of our knowledge this is the first report of CVd-V in citrus trees in Turkey.
Full text of article

Research topic(s) for pests/diseases/weeds:
general biology - morphology - evolution

---

Pest and/or beneficial records:

Beneficial	Pest/Disease/Weed	Crop/Product	Country	Quarant.
	Citrus viroid V	Citrus (genus)	Turkey