Journal of Plant Pathology (2006) 88, p. S40a (Davino et al.)

From Pestinfo-Wiki
Jump to: navigation, search

S. Davino, M. Davino and M.G. Bellardi (2006)
Molecular characterization of Cucumber mosaic virus isolates infecting ornamental species cultivated in the Botanical Garden of the University of Bologna
Journal of Plant Pathology 88 (3, Special Issue), S40-S40
S.I.Pa.V XIII National Meeting - Foggia, 12-16 September 2006 - Poster
Abstract: During an epidemiological survey carried out in the Botanical Garden of the University of Bologna Cucumber mosaic virus (CMV) was detected by PAS-ELISA in some ornamental species exhibiting a severe symptomatology of the leaves. Datura innoxia showed mosaic and leaf curling; Globularia nudicaulis produced narrow leaves with yellow mosaic and/or variegation; Eupatorium cannabinum showed a systemic chlorotic and/or yellow mosaic and stunting. RT-PCR and single strand conformation polymorphism (SSCP) were used to characterise these CMV isolates. Total RNA was extracted from symptomatic leaf samples with a Qiagen RNeasy Plant Minikit (Qiagen., Milan, Italy) according to the manufacturer's instructions. RT-PCR was carried out using specific primers for the movement protein gene of CMV RNA-3 (forward MP+ CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt). All samples from the three ornamental species yielded DNA fragments of the expected size (841 bp). PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with CMV isolates from other ornamental species present in the same Botanical Garden (Thevetia nereifolia and Nandina domestica). The results showed a different sequence variant for each CMV isolate, indicating that these tree isolates may have come from the country of orign of the hosts.
Database assignments for author(s): Salvatore Walter Davino, Maria Grazia Bellardi

Research topic(s) for pests/diseases/weeds:
molecular biology - genes


Pest and/or beneficial records:

Beneficial Pest/Disease/Weed Crop/Product Country Quarant.


Cucumber mosaic virus Italy